Product Description

CD7 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0223-500, NCP0223-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD7 is a type-I transmembrane glycoprotein belonging to the immunoglobμlin superfamily. CD7 is one of the earliest surface markers to be expressed on the surface of developing T cells and its expression is maintained throughout maturation of mμltiple T cell subsets and NK cells. Engagement of CD7 through binding its ligand, SECTM1, has been shown to promote tyrosine phosphorylation of its cytoplasmic domain, recruitment of PI3K, and delivery of costimμlatory signals for T cell activation. While CD7 is expressed on normal T cells, it is also highly expressed in a variety of T cell malignancies, which has poised it as a potential target of immunotherapy.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~24kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P09564

Tag: His-tag

Amino Acid Sequence: GCACAGGAAGTGCAGCAGAGTCCGCATTGCACCACCGTTCCGGTTGGTGCCAGTGTTAATATTACCTGTAGTACCAGCGGCGGCCTGCGCGGCATCTATCTGCGCCAGCTGGGCCCGCAGCCGCAGGACATTATCTATTATGAAGATGGCGTTGTGCCGACCACCGATCGCCGCTTCCGCGGTCGTATTGACTTCAGTGGCAGCCAGGATAATCTGACCATTACCATGCATCGTCTGCAGCTGAGCGATACCGGCACCTATACCTGTCAGGCCATTACCGAAGTGAATGTGTATGGTAGCGGTACCCTGGTTCTGGTGACCGAAGAACAGAGCCAGGGCTGGCATCGCTGCAGTGATGCACCGCCGCGTGCAAGTGCACTGCCGGCACCTCCGACCGGTAGTGCACTGCCTGATCCGCAGACCGCAAGCGCACTGCCGGATCCGCCGGCTGCTAGTGCACTGCCA

Expression Vector: pet-22b(+)

Research Use Only