Product Description

CD7 Recombinant Protein

Catalogue Number: NCP0223-500, NCP0223-1000

Sizes: 500ug, 1mg

Swiss-Prot: P09564

Host: E.coli

Tag: His-tag

AA Sequence: GCACAGGAAGTGCAGCAGAGTCCGCATTGCACCACCGTTCCGGTTGGTGCCAGTGTTAATATTACCTGTAGTACCAGCGGCGGCCTGCGCGGCATCTATCTGCGCCAGCTGGGCCCGCAGCCGCAGGACATTATCTATTATGAAGATGGCGTTGTGCCGACCACCGATCGCCGCTTCCGCGGTCGTATTGACTTCAGTGGCAGCCAGGATAATCTGACCATTACCATGCATCGTCTGCAGCTGAGCGATACCGGCACCTATACCTGTCAGGCCATTACCGAAGTGAATGTGTATGGTAGCGGTACCCTGGTTCTGGTGACCGAAGAACAGAGCCAGGGCTGGCATCGCTGCAGTGATGCACCGCCGCGTGCAAGTGCACTGCCGGCACCTCCGACCGGTAGTGCACTGCCTGATCCGCAGACCGCAAGCGCACTGCCGGATCCGCCGGCTGCTAGTGCACTGCCA

Restriction Sites: NdeI-XhoI

Background: CD7 is a type-I transmembrane glycoprotein belonging to the immunoglobulin superfamily. CD7 is one of the earliest surface markers to be expressed on the surface of developing T cells and its expression is maintained throughout maturation of multiple T cell subsets and NK cells. Engagement of CD7 through binding its ligand, SECTM1, has been shown to promote tyrosine phosphorylation of its cytoplasmic domain, recruitment of PI3K, and delivery of costimulatory signals for T cell activation. While CD7 is expressed on normal T cells, it is also highly expressed in a variety of T cell malignancies, which has poised it as a potential target of immunotherapy.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~24kDa

Notes: For research use only, not for use in diagnostic procedure.