Product Description

CD70 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0224-500, NCP0224-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD70 is a type II transmembrane glycoprotein and a member of the tumor necrosis factor ligand superfamily (TNFSF), also known as CD27L and TNFSF7. It is normally expressed on medμllary thymic epithelial cells. Its expression is induced on activated lymphoid cells (B cells, T cells, and NK cells) and dendritic cells. CD70 is a ligand for CD27, a co-stimμlatory receptor that plays an important role in T cell activation and proliferation. CD70 overexpression has been reported in various tumors such as renal cell carcinoma, glioblastoma, and non-small cell lung carcinoma and it’s being actively pursued as a therapeutic target.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~17kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P32970

Tag: His-tag

Amino Acid Sequence: CAGCGCTTCGCACAGGCACAGCAGCAGCTGCCGCTGGAAAGTCTGGGTTGGGATGTGGCAGAACTGCAGCTGAATCATACCGGCCCGCAGCAGGATCCGCGTCTGTATTGGCAGGGCGGCCCGGCTCTGGGTCGTAGCTTCCTGCATGGTCCGGAACTGGATAAAGGCCAGCTGCGCATTCATCGTGATGGTATCTATATGGTTCATATTCAGGTGACCCTGGCAATCTGTAGCAGTACCACCGCAAGTCGCCATCATCCGACCACCCTGGCAGTTGGTATCTGTAGTCCGGCCAGCCGTAGCATTAGCCTGCTGCGTCTGAGCTTCCATCAGGGCTGTACCATTGCAAGTCAGCGCCTGACCCCGCTGGCACGTGGCGATACCCTGTGCACCAATCTGACCGGTACCCTGCTGCCGAGTCGTAATACCGATGAAACCTTCTTCGGTGTGCAGTGGGTGCGTCCG

Expression Vector: pet-22b(+)

Research Use Only