Skip to product information
1 of 1

Bioworld

CD71/TfR Recombinant Protein - NCP0225

CD71/TfR Recombinant Protein - NCP0225

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD71/TfR Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0225-500, NCP0225-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Transferrin receptor 1 (CD71, TFRC) is a type II transmembrane receptor and carrier protein responsible for the uptake of cellμlar iron through receptor-mediated endocytosis. Neutral pH at the cell surface promotes binding of the iron-binding glycoprotein transferrin (Tf) to the CD71 receptor. The receptor-ligand complex enters the cell through receptor-mediated endocytosis and is internalized into an endosome. Relatively lower endosomal pH leads to a change in the local charge environment surrounding the iron-transferrin binding site and resμlts in the release of iron. The receptor-ligand complex is recycled to the cell surface where transferrin dissociates from the CD71 receptor. Ubiquitously expressed transferrin receptor is continuously recycled and undergoes clathrin-mediated endocytosis regardless of ligand binding state. The interaction between receptor and ligand has been studied in detail. The helical domain of CD71 directly interacts with the transferrin C-lobe and induces a conformation change in Tf to facilitate the transport process. Interaction between the receptor CD71 and transferrin is mediated by the membrane protein hemochromatosis (HFE). HFE binds the α-helical domain of CD71, blocking formation of the CD71-transferrin complex and inhibiting iron uptake. In addition to binding transferrin, CD71 also interacts with H-ferritin at the cell surface and transports this intracellμlar iron storage protein to cellμlar endosomes and lysosomes. Additional studies indicate that the transferrin receptor is an evolutionarily conserved receptor for a number or arenaviruses and at least one retrovirus. Aberrant expression of CD71 is seen in a number of cancers, including thyroid carcinomas, lymphomas, and T-lineage leukemias, suggesting a possible therapeutic role for targeted inhibition of the transferrin receptor.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~27kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P02786

Tag: His-tag

Amino Acid Sequence: CAGAATGTTAAGCATCCGGTTACCGGCCAGTTCCTGTATCAGGATAGTAATTGGGCAAGCAAAGTGGAAAAACTGACCCTGGATAATGCAGCCTTCCCGTTCCTGGCATATAGTGGCATTCCGGCAGTGAGCTTCTGCTTCTGTGAAGATACCGATTATCCGTATCTGGGTACCACCATGGATACCTATAAAGAACTGATTGAACGTATTCCGGAACTGAATAAAGTTGCACGCGCAGCAGCCGAAGTGGCCGGTCAGTTCGTTATTAAACTGACCCATGATGTGGAACTGAATCTGGATTATGAACGCTATAATAGTCAGCTGCTGAGCTTCGTGCGTGATCTGAATCAGTATCGCGCAGATATTAAAGAAATGGGCCTGAGTCTGCAGTGGCTGTATAGTGCACGTGGCGACTTCTTCCGTGCCACCAGTCGCCTGACCACCGACTTCGGCAATGCAGAAAAAACCGATCGCTTCGTGATGAAAAAACTGAATGATCGTGTTATGCGCGTGGAATATCACTTCCTGAGCCCGTATGTGAGCCCGAAAGAAAGCCCGTTCCGTCATGTGTTCTGGGGCAGTGGCAGTCATACCCTGCCGGCACTGCTGGAAAATCTGAAACTGCGTAAACAGAATAATGGTGCATTCAATGAAACCTTATTCCGTAATCAGCTGGCCCTGGCAACCTGGACCATTCAGGGCGCCGCAAATGCACTGAGCGGC

Expression Vector: pet-22b(+)

Research Use Only

View full details