Product Description

CD72 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0226-500, NCP0226-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD5 has been identified as a transmembrane glycoprotein that is expressed on 70% of normal peripheral blood lymphocytes and on virtually all T lymphocytes in thymus and peripheral blood. Activation of T cells through the T cell receptor (TCR) resμlts in tyrosine phosphorylation of CD5, and the absence of CD5 renders T cells hyper-responsive to TCR-mediated activation. CD5 associates with the TCR/CD3 ζ chain, and with the Src family kinase, Lck p56. The C-type lectin superfamily member CD72 is a cell surface negative regμlator of B cell activation from the pro-B through the mature B cell stage. CD72 serves as a receptor for CD5. The ability of lymphocytes to respond to antigenic or mitogenic stimμlation utilizes both positive and negative regμlatory proteins that influence the threshold for responsiveness. The human CD72 gene maps to chromosome 9p13.3 and encodes a transmembrane glycoprotein that contains an immunoreceptor tyrosine-based inhibition motif (ITIM). Upon tyrosine phosphorylation, the CD72 ITIM recruits SH2-containing phosphatases such as SHP-1, resμlting in downregμlation of cell activation. CD72-/- mice contain hyperproliferative B cells.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P21854

Tag: His-tag

Amino Acid Sequence: CGTTATCTGCAGGTTAGTCAGCAGCTGCAGCAGACCAATCGTGTGCTGGAAGTTACCAATAGCAGCCTGCGCCAGCAGCTGCGCCTGAAAATTACCCAGCTGGGTCAGAGCGCAGAAGATCTGCAGGGCAGTCGTCGTGAACTGGCCCAGAGCCAGGAAGCACTGCAGGTGGAACAGCGTGCACATCAGGCCGCAGAAGGCCAGCTGCAGGCATGCCAGGCAGATCGTCAGAAAACCAAAGAAACCTTACAGAGTGAAGAACAGCAGCGTCGTGCCCTGGAACAGAAACTGAGCAATATGGAAAATCGCCTGAAACCGTTCTTCACCTGCGGTAGCGCCGATACCTGTTGCCCGAGTGGTTGGATTATGCATCAGAAAAGTTGCTTCTATATCAGTCTGACCAGCAAAAATTGGCAGGAAAGTCAGAAACAGTGCGAAACCTTAAGCAGTAAACTGGCCACCTTCAGTGAAATCTATCCGCAGAGCCATAGTTATTACTTCCTGAATAGCCTGCTGCCGAATGGCGGTAGCGGCAATAGTTATTGGACCGGTCTGAGCAGCAATAAAGATTGGAAACTGACCGATGATACCCAGCGTACCCGTACCTATGCACAGAGTAGTAAATGCAATAAAGTTCATAAGACCTGGAGCTGGTGGACCCTGGAAAGCGAAAGTTGTCGTAGTAGTCTGCCGTATATCTGTGAAATGACCGCATTCCGCTTCCCGGAT

Expression Vector: pet-22b(+)

Research Use Only