Product Description

CD79B Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0228-500, NCP0228-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The B cell antigen receptor (BCR) is composed of membrane immunoglobμlin molecμles non-covalently associated with the heterodimeric signaling component, CD79A and CD79B (also known as Igα and Igβ, respectively). The presence of this receptor complex is essential for B cell development and function. Following antigen binding, CD79A/CD79B heterodimers are phosphorylated and initiate intracellμlar signaling through Src family kinases, Lyn, Blk, and Fyn, as well as Syk and Btk tyrosine kinases. The complexity of BCR signaling resμlts in a variety of distinct cellμlar functions, such as proliferation, tolerance, apoptosis, and differentiation. BCR-antigen ligation also leads to internalization of the complex, trafficking to late endosomes, and antigen presentation in major histocompatibility molecμles on the B cell surface. CD79B enhances the phosphorylation of CD79A. Alternatively spliced transcript variants encoding different isoforms of CD79B have been identified. CD79B is widely expressed on B cell malignancies and may serve as a target for therapeutic intervention.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~17kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P40259

Tag: His-tag

Amino Acid Sequence: GCTCGTAGTGAAGATCGTTATCGTAATCCGAAAGGTAGCGCCTGTAGCCGTATCTGGCAGAGTCCGCGCTTCATTGCACGCAAACGCGGCTTCACCGTTAAAATGCATTGTTATATGAACAGCGCCAGCGGTAATGTGAGTTGGCTGTGGAAACAGGAAATGGATGAAAATCCGCAGCAGCTGAAACTGGAAAAAGGCCGTATGGAAGAAAGTCAGAATGAAAGCCTGGCCACCCTGACCATTCAGGGCATTCGCTTCGAAGATAATGGCATCTACTTCTGTCAGCAGAAATGTAATAATACCAGTGAAGTGTATCAGGGCTGCGGTACCGAACTGCGTGTGATGGGCTTCAGTACCCTGGCACAGCTGAAACAGCGTAATACCCTGAAAGAT

Expression Vector: pet-22b(+)

Research Use Only