Product Description

CD81 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0230-500, NCP0230-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD81 belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellμlar domain (ECL1), and one long extracellμlar domain (ECL2). Tetraspanins interact with a variety of cell surface proteins and intracellμlar signaling molecμles in specialized tetraspanin enriched microdomains (TEMs) where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction (3). CD81, like other tetraspanins, is enriched in exosomes. Many research studies demonstrate a role for CD81 in lymphocyte signaling. CD81 is also a well-characterized receptor for Hepatitis C Virus and facilitates the entry of the virus into target cells.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~10kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P60033

Tag: His-tag

Amino Acid Sequence: TTCGTTAACAAGGATCAGATTGCAAAAGATGTGAAACAGTTCTATGATCAGGCCCTGCAGCAGGCAGTGGTGGATGATGATGCAAATAATGCCAAAGCAGTTGTGAAAACCTTCCATGAAACCTTAGATTGTTGCGGCAGCAGTACCCTGACCGCACTGACCACCAGTGTGCTGAAAAATAATCTGTGCCCGAGCGGTAGCAATATTATTAGTAATCTGTTCAAGGAGGACTGCCATCAGAAAATTGATGATCTGTTCAGTGGCAAA

Expression Vector: pet-22b(+)

Research Use Only