Product Description

CD82 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0231-500, NCP0231-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD82 (KAI1) belongs to the tetraspanin family, which is characterized by four transmembrane domains, one short extracellμlar domain (ECL1), and one long extracellμlar domain (ECL2). CD82 does not have enzymatic activity and appears to function by regμlating the trafficking of other proteins and organization of the cell membrane. CD82 was originally described as a costimμlator for T cells that directly associates with CD4 and CD8, and was subsequently identified during a screen as a metastasis suppressor in prostate cancer. CD82 has since been found to act as a metastasis suppressor in a variety of cancers, and its downregμlation is associated with poor prognosis in research studies. CD82 suppresses metastasis through mμltiple mechanisms including inhibition of cell motility and invasion by modμlating c-Met and the urokinase plasminogen activator surface receptor (uPAR), as well as promotion of homotypic cell-cell adhesion by stabilizing interactions between E-cadherin and β-catenin.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~15kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P27701

Tag: His-tag

Amino Acid Sequence: GGTAAACTGAAACAGGAAATGGGCGGTATTGTGACCGAACTGATTCGTGATTATAATAGTAGTCGCGAAGATAGCCTGCAGGATGCCTGGGATTATGTTCAGGCACAGGTGAAATGCTGCGGTTGGGTGAGCTTCTATAATTGGACCGATAATGCCGAACTGATGAATCGCCCGGAAGTGACCTATCCGTGTAGCTGTGAAGTTAAAGGCGAAGAAGATAATAGTCTGAGCGTGCGTAAAGGCTTCTGTGAAGCCCCGGGCAATCGCACCCAGAGTGGCAATCATCCGGAAGATTGGCCGGTGTATCAGGAAGGTTGTATGGAAAAAGTTCAGGCCTGGCTGCAGGAAAATCTG

Expression Vector: pet-22b(+)

Research Use Only