CD83 Recombinant Protein - NCP0232

CD83 Recombinant Protein

Catalogue Number: NCP0232-500, NCP0232-1000

Sizes: 500ug, 1mg

Swiss-Prot: Q01151

Host: E.coli

Tag: His-tag

AA Sequence: ACCCCTGAAGTGAAAGTGGCATGTAGTGAAGATGTGGATCTGCCGTGTACCGCCCCGTGGGATCCGCAGGTGCCGTATACCGTGAGTTGGGTGAAACTGCTGGAAGGTGGTGAAGAACGCATGGAAACACCTCAGGAAGATCATCTGCGTGGCCAGCATTATCATCAGAAAGGTCAGAATGGTAGCTTCGATGCACCGAATGAACGTCCGTATAGTCTGAAAATTCGTAATACCACCAGTTGTAATAGCGGCACCTATCGTTGTACCCTGCAGGATCCGGATGGTCAGCGTAATCTGAGCGGTAAAGTTATTCTGCGCGTTACCGGCTGCCCGGCCCAGAGAAAAGAAGAAACCTTCAAAAAATACCGCGCAGAA

Restriction Sites: NdeI-XhoI

Background: CD83 is a single-transmembrane protein with a calculated molecular weight (MW) of 23 kDa, but due to heavy and differential glycosylation, its apparent MW ranges from 23 to 70 kDa. CD83 is predominantly expressed on mature dendritic cells (DCs) and has been used as a DC activation/maturation marker as its increased expression is correlated with upregulation of HLA class II antigen expression on DCs. CD83 is also expressed at a low level on lymphocytes and is upregulated upon lymphocyte activation. Thymic epithelial cells also express CD83, which is required for normal CD4+ T cell development. CD83 is also expressed as a soluble form (sCD83) that can be found in serum of healthy adults. sCD83 has been shown to negatively regulate immune response by lymphocytes.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~19kDa

Notes: For research use only, not for use in diagnostic procedure.