Skip to product information
1 of 1

Bioworld

CD86 Recombinant Protein - NCP0233

CD86 Recombinant Protein - NCP0233

Regular price $1,152.00 CAD
Regular price Sale price $1,152.00 CAD
Sale Sold out
Size
Quantity

Get a quote

CD86 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0233-500, NCP0233-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regμlate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregμlated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimμlatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which resμlts in the downregμlation of T cell activity.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~30kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P42081

Tag: His-tag

Amino Acid Sequence: GCTCCTCTGAAAATTCAGGCATACTTCAATGAAACCGCAGATCTGCCGTGTCAGTTCGCCAATAGTCAGAATCAGAGCCTGAGCGAACTGGTGGTGTTCTGGCAGGATCAGGAAAATCTGGTGCTGAATGAAGTGTATCTGGGTAAAGAAAAATTCGATAGTGTTCATAGTAAGTACATGGGCCGCACCAGCTTCGATAGTGATAGCTGGACCCTGCGTCTGCATAATCTGCAGATTAAAGATAAAGGTCTGTATCAGTGCATTATTCATCATAAAAAGCCGACCGGTATGATTCGCATTCATCAGATGAATAGTGAACTGAGTGTTCTGGCAAACTTCAGTCAGCCGGAAATTGTTCCGATTAGTAATATTACCGAAAACGTGTATATCAACCTGACCTGTAGCAGCATTCATGGTTATCCGGAACCGAAAAAAATGAGCGTTCTGCTGCGCACCAAAAATAGTACCATTGAATATGATGGCGTGATGCAGAAAAGTCAGGATAATGTTACCGAACTGTATGATGTGAGCATTAGCCTGAGCGTTAGCTTCCCGGATGTGACCAGTAATATGACCATCTTCTGCATTCTGGAAACCGATAAAACCAGACTGCTGAGTAGCCCGTTCAGTATTGAACTGGAAGATCCGCAGCCGCCGCCGGATCATATTCCG

Expression Vector: pet-22b(+)

Research Use Only

View full details