Skip to product information
1 of 1

BioWorld

CD86 Recombinant Protein - NCP0233

CD86 Recombinant Protein - NCP0233

Regular price $1,050.83 CAD
Regular price Sale price $1,050.83 CAD
Sale Sold out
Size
Quantity

Get a quote

CD86 Recombinant Protein

Catalogue Number: NCP0233-500, NCP0233-1000

Sizes: 500ug, 1mg

Swiss-Prot: P42081

Host: E.coli

Tag: His-tag

AA Sequence: GCTCCTCTGAAAATTCAGGCATACTTCAATGAAACCGCAGATCTGCCGTGTCAGTTCGCCAATAGTCAGAATCAGAGCCTGAGCGAACTGGTGGTGTTCTGGCAGGATCAGGAAAATCTGGTGCTGAATGAAGTGTATCTGGGTAAAGAAAAATTCGATAGTGTTCATAGTAAGTACATGGGCCGCACCAGCTTCGATAGTGATAGCTGGACCCTGCGTCTGCATAATCTGCAGATTAAAGATAAAGGTCTGTATCAGTGCATTATTCATCATAAAAAGCCGACCGGTATGATTCGCATTCATCAGATGAATAGTGAACTGAGTGTTCTGGCAAACTTCAGTCAGCCGGAAATTGTTCCGATTAGTAATATTACCGAAAACGTGTATATCAACCTGACCTGTAGCAGCATTCATGGTTATCCGGAACCGAAAAAAATGAGCGTTCTGCTGCGCACCAAAAATAGTACCATTGAATATGATGGCGTGATGCAGAAAAGTCAGGATAATGTTACCGAACTGTATGATGTGAGCATTAGCCTGAGCGTTAGCTTCCCGGATGTGACCAGTAATATGACCATCTTCTGCATTCTGGAAACCGATAAAACCAGACTGCTGAGTAGCCCGTTCAGTATTGAACTGGAAGATCCGCAGCCGCCGCCGGATCATATTCCG

Restriction Sites: NdeI-XhoI

Background: CD80 (B7-1, BB1) and CD86 (B7-2, B70) are members of the B7 family of cell surface ligands that regulate T cell activation and immune responses. CD80 is expressed on activated antigen presenting cells, including dendritic cells, B cells, monocytes, and macrophages. CD86 is expressed on resting monocytes, dendritic cells, activated B lymphocytes, and can be further upregulated in the presence of inflammation. CD80 and CD86 are ligands for CD28, which functions as a T cell costimulatory receptor. Interaction of CD28 with CD80 or CD86 provides the second signal required for naïve T cell activation, T cell proliferation, and acquisition of effector functions. Alternatively, CD80 and CD86 also act as ligands to CTLA-4, which results in the downregulation of T cell activity.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~30kDa

Notes: For research use only, not for use in diagnostic procedure.

View full details