Product Description

CD8A Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0234-500, NCP0234-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: Cluster of Differentiation 8 (CD8) is a disμlphide-linked heterodimer consisting of the unrelated α and β subunits. Each subunit is a glycoprotein composed of a single extracellμlar Ig-like domain, a polypeptide linker, a transmembrane part and a short cytoplasmic tail. On T cells, CD8 is the coreceptor for the T cell receptor (TCR), and these two distinct structures recognize the Antigen–Major Histocompatibility Complex (MHC). Specifically, the Ig-like domain of CD8α interacts with the α3-domain of the MHC class I molecμle. CD8 ensures specificity of the TCR–antigen interaction, prolongs the contact between the T cell and the antigen presenting cell, and the α chain recruits the tyrosine kinase Lck, which is essential for T cell activation.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~18kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P01732

Tag: His-tag

Amino Acid Sequence: AGTCAGTTCCGTGTGAGTCCGCTGGATCGTACCTGGAATCTGGGTGAAACCGTTGAACTGAAATGCCAGGTTCTGCTGAGCAATCCGACCAGCGGTTGTAGCTGGCTGTTCCAGCCGCGTGGTGCCGCAGCAAGCCCGACATTCCTGCTGTATCTGAGTCAGAATAAACCGAAAGCCGCAGAAGGCCTGGATACCCAGCGCTTCAGTGGTAAACGCCTGGGCGATACCTTCGTGCTGACCCTGAGCGACTTCCGTCGTGAAAATGAAGGCTATTACTTCTGCAGCGCACTGAGTAATAGTATTATGTACTTCAGCCACTTCGTGCCGGTGTTCCTGCCGGCAAAACCGACCACCACCCCGGCCCCTCGCCCTCCTACACCTGCACCTACCATTGCCAGTCAGCCGCTGAGCCTGCGCCCGGAAGCCTGTCGTCCGGCAGCAGGTGGCGCCGTTCATACCCGCGGTCTGGACTTCGCCTGTGAT

Expression Vector: pet-22b(+)

Research Use Only