Product Description

CD9 Recombinant Protein

Catalogue Number: NCP0236-500, NCP0236-1000

Sizes: 500ug, 1mg

Swiss-Prot: P21926

Host: E.coli

Tag: His-tag

AA Sequence: AGTCATAAGGATGAAGTGATTAAGGAAGTGCAGGAATTCTATAAAGATACCTATAATAAGCTGAAGACCAAAGATGAACCGCAGCGTGAAACCTTAAAAGCAATTCATTATGCCCTGAATTGCTGTGGTCTGGCAGGTGGCGTGGAACAGTTCATTAGTGATATCTGTCCGAAAAAAGATGTTCTGGAAACCTTCACCGTTAAAAGCTGCCCGGATGCCATTAAAGAAGTGTTCGATAATAAATTCCACATC

Restriction Sites: NdeI-XhoI

Background: The CD9 antigen belongs to the tetraspanin family of cell surface glycoproteins, and is characterized by four transmembrane domains, one short extracellular domain (ECL1), and one long extracellular domain (ECL2). Tetraspanins interact with a variety of cell surface proteins and intracellular signaling molecules in specialized tetraspanin-enriched microdomains (TEMs), where they mediate a range of processes including adhesion, motility, membrane organization, and signal transduction. Research studies demonstrate that CD9 expression on the egg is required for gamete fusion during fertilization. CD9 was also shown to play a role in dendritic cell migration, megakaryocyte differentiation, and homing of cord blood CD34+ hematopoietic progenitors to the bone marrow. In addition, down regulation of CD9 expression is associated with poor prognosis and progression of several types of cancer. Additional research identified CD9 as an abundant component of exosomes, and may play some role in the fusion of these secreted membrane vesicles with recipient cells.

Soluble: PBS, 4M Urea, PH7.4

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Expression Vector: pet-22b(+)

BioWorld Molecular Weight: ~9kDa

Notes: For research use only, not for use in diagnostic procedure.