Product Description

IL-4R/CD124 Recombinant Protein

Sizes: 500μg, 1mg

Catalogue Numbers: NCP0241-500, NCP0241-1000

Lead times: 1-2 weeks, if manufacturer has product in stock

Manufacturer/Ship Location: China

Background: The IL-2 receptor is a mμlticomponent complex consisting of three subunits, α, β and γ, each of which is required for high affinity binding of IL-2. The α chain functions primarily in binding IL-2, whereas the β and γ chains contribute to IL-2 binding and are essential to IL-2-induced activation of signaling pathways leading to T cell growth. Both IL-4R and IL-7R were initially described as single chain, high-affinity ligand-binding cytokine receptors. However, it is now well established that the IL-2Rγ chain functions as a second subunit of the high affinity IL-4R and IL-7R receptors. Consequently, the originally described subunits of these latter receptors are now referred to as IL-4Rα and IL-7Rα, respectively, while the common subunit is referred to as γc. Although the common γ chain enhances ligand binding in these three cytokine receptors, it has no capacity to bind these ligands on its own. There is evidence that the γc chain is also a subunit of IL-13R.

Category: Protein

Host: E. coli

Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).

Molecular Weight: ~25kDa

Solubility: PBS, 4M Urea, PH7.4

Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.

Restriction Sites: NdeI-XhoI

SwissProt: P24394

Tag: His-tag

Amino Acid Sequence: AAGGTGCTGCAGGAACCGACCTGCGTTAGTGATTATATGAGCATTAGCACCTGTGAATGGAAAATGAATGGTCCGACCAATTGCAGTACCGAACTGCGCCTGCTGTATCAGCTGGTGTTCCTGCTGAGCGAAGCACATACCTGTATTCCGGAAAATAATGGCGGCGCCGGCTGTGTGTGTCATCTGCTGATGGATGATGTTGTGAGCGCCGATAATTATACCCTGGATCTGTGGGCAGGCCAGCAGCTGCTGTGGAAAGGTAGCTTCAAACCGAGTGAACATGTTAAACCGCGCGCCCCGGGCAATCTGACCGTTCATACCAATGTTAGCGATACCCTGCTGCTGACCTGGAGCAATCCGTATCCGCCGGATAATTATCTGTATAATCATCTGACCTACGCCGTTAATATCTGGAGCGAAAATGATCCGGCAGACTTCCGTATCTATAATGTTACCTATCTGGAACCGAGCCTGCGTATTGCCGCAAGTACCCTGAAAAGTGGCATTAGTTATCGTGCCCGTGTGCGCGCCTGGGCCCAGTGCTATAATACCACCTGGAGCGAATGGAGCCCGAGTACCAAATGGCATAATAGCTATCGTGAACCGTTCGAACAGCAT

Expression Vector: pet-22b(+)

Research Use Only