Bioworld
IL7R/CD127 Recombinant Protein - NCP0242
IL7R/CD127 Recombinant Protein - NCP0242
Couldn't load pickup availability
IL7R/CD127 Recombinant Protein
Sizes: 500μg, 1mg
Catalogue Numbers: NCP0242-500, NCP0242-1000
Lead times: 1-2 weeks, if manufacturer has product in stock
Manufacturer/Ship Location: China
Background: Interleukin 7 (IL-7) was originally described as a factor capable of inducing in vitro proliferation of pre-B cells from marrow cμltures. The IL-7 gene encodes a protein 177 amino acids in length. IL-7 exerts its biological function through the IL-7 receptor which is expressed on pre-B cells, thymocytes and bone marrow-derived macrophages. The IL-7 receptor is composed of an IL-7 receptor-specific chain and the IL-2 receptor γ chain common to the IL-2, IL-4, IL-7, IL-9 and IL-15 receptors. IL-7 stimμlation leads to the activation of Janus tyrosine kinase family members JAK1 and JAK3. Other studies have shown that in T cells, the IL-7 receptor-specific chain associates with the Src kinases family Lck and Fyn. IL-7 induces phosphorylation of insμlin receptor substrate-1 (IRS-1) and Insμlin receptor substrate-2 (IRS-2), originally called 4PS.
Category: Protein
Host: E. coli
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Molecular Weight: ~28kDa
Solubility: PBS, 4M Urea, PH7.4
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Restriction Sites: NdeI-XhoI
SwissProt: P16871
Tag: His-tag
Amino Acid Sequence: GAAAGCGGTTATGCCCAGAATGGTGATCTGGAAGATGCAGAACTGGATGATTATAGCTTCAGTTGTTATAGTCAGCTGGAAGTGAATGGCAGCCAGCATAGCCTGACCTGCGCATTCGAAGATCCGGATGTTAATATTACCAATCTGGAATTCGAAATCTGCGGCGCACTGGTTGAAGTGAAATGCCTGAACTTCCGCAAACTGCAGGAAATCTACTTCATTGAAACCAAAAAATTCCTGCTGATTGGTAAAAGCAATATCTGTGTTAAAGTGGGTGAAAAAAGCCTGACCTGTAAAAAAATTGATCTGACCACCATTGTGAAACCGGAAGCACCGTTCGATCTGAGTGTGGTGTATCGTGAAGGCGCAAATGACTTCGTGGTGACCTTCAATACCAGTCATCTGCAGAAAAAATATGTTAAAGTGCTGATGCATGACGTGGCATATCGCCAGGAAAAAGATGAAAATAAATGGACCCATGTTAACCTGAGTAGTACCAAACTGACCCTGCTGCAGCGTAAACTGCAGCCGGCAGCCATGTATGAAATTAAAGTTCGTAGCATTCCGGATCATTACTTCAAAGGCTTCTGGAGCGAATGGAGTCCGAGTTATTACTTCCGCACCCCGGAAATTAATAATAGTAGTGGTGAAATGGAC
Expression Vector: pet-22b(+)
Research Use Only
