BioWorld
Integrin α3 (CD49c) Recombinant Protein - NCP0243
Integrin α3 (CD49c) Recombinant Protein - NCP0243
Couldn't load pickup availability
Integrin α3 (CD49c) Recombinant Protein
Catalogue Number: NCP0243-500, NCP0243-1000
Sizes: 500ug, 1mg
Swiss-Prot: P26006
Host: E.coli
Tag: His-tag
AA Sequence: TTCGGTTATAGTGTTGCCCTGCATCGCCAGACCGAACGTCAGCAGCGCTATCTGCTGCTGGCCGGTGCCCCGCGTGAACTGGCAGTTCCGGATGGTTATACCAATCGTACCGGTGCAGTGTATCTGTGCCCGCTGACCGCACATAAAGATGATTGCGAACGTATGAATATTACCGTGAAAAATGATCCGGGTCATCATATTATTGAAGATATGTGGCTGGGTGTGACCGTTGCCAGCCAGGGTCCGGCAGGCCGTGTTCTGGTGTGTGCCCATCGTTATACCCAGGTTCTGTGGAGTGGTAGTGAAGATCAGCGCCGTATGGTTGGCAAATGTTATGTGCGTGGTAATGATCTGGAACTGGATAGTAGTGATGATTGGCAGACCTATCATAATGAAATGTGCAATAGTAACACCGATTATCTGGAAACCGGCATGTGCCAGCTGGGTACCAGTGGCGGCTTCACCCAGAATACCGTGTACTTCGGTGCACCGGGTGCCTATAATTGGAAAGGTAATAGTTATATGATCCAGCGCAAAGAATGGGATCTGAGCGAATATAGTTATAAAGATCCGGAAGATCAGGGTAATCTGTATATTGGTTATACCATGCAGGTTGGTAGCTTCATTCTGCATCCGAAAAATATTACCATTGTTACCGGCGCCCCGCGCCATCGCCACATGGGTGCAGTGTTCCTGCTGAGTCAGGAAGCCGGTGGTGATCTGCGTCGCCGCCAGGTTCTGGAAGGTAGTCAGGTGGGTGCCTACTTCGGTAGCGCAATTGCACTGGCCGATCTGAATAATGATGGTTGGCAGGATCTGCTGGTGGGCGCACCGTATTACTTCGAACGCAAAGAAGAAGTGGGCGGCGCCATCTATGTGTTCATGAATCAGGCAGGCACCAGCTTCCCGGCACATCCGAGCCTGCTGCTGCATGGCCCGAGCGGTAGTGCCTTCGGCCTGAGTGTGGCCAGCATT
Restriction Sites: NdeI-XhoI
Background: Integrins are heterodimers composed of non-covalently associated transmembrane α and β subunits. The 16 α and 8 β subunits heterodimerize to produce more than 20 different receptors. Most integrin receptors bind ligands that are components of the extracellular matrix, including Fibronectin, Collagen and Vitronectin. Certain integrins can also bind to soluble ligands such as Fibrinogen, or to counterreceptors on adjacent cells such as the intracellular adhesion molecules (ICAMs), leading to aggregation of cells. Ligands serve to cross-link or cluster integrins by binding to adjacent integrin receptors; both receptor clustering and ligand occupancy are necessary for the activation of integrin-mediated responses. In addition to mediating cell adhesion and cytoskeletal organization, integrins function as signaling receptors. Signals
transduced by integrins play a role in many biological processes, including cell growth, differentiation, migration and apoptosis. The Integrin α3 chain, also known as very late (activation) antigen 3 (VLA-3), very common antigen 2 (VCA-2), extracellular matrix receptor 1 (ECMR1) and galactoprotein b3 (GAPB3), undergoes posttranslational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that join with β1 to form an integrin that interacts with many extracellular-matrix proteins.
Soluble: PBS, 4M Urea, PH7.4
Purification and Purity: Transferred into competent cells and the supernatant was purified by NI column affinity chromatography and the purity is > 85% (by SDS-PAGE).
Storage and Stability: Store at 4°C short term. Aliquot and store at -20°C long term. Avoid freeze-thaw cycles.
Expression Vector: pet-22b(+)
BioWorld Molecular Weight: ~36kDa
Notes: For research use only, not for use in diagnostic procedure.